OUP user menu

‘Real-time’ PCR based detection of Coxiella burnetii using conventional techniques

Dimitrios Frangoulidis, Hermann Meyer, Claudia Kahlhofer, Wolf D. Splettstoesser
DOI: http://dx.doi.org/10.1111/j.1574-695X.2011.00900.x 134-136 First published online: 1 February 2012


The diagnosis of Q fever (Coxiella burnetii infection) relies primarily on the serological detection of specific antibodies. Recently, PCR-based methods have been introduced in diagnostic laboratories. Unfortunately, the fastest and most reliable ‘real-time’ detection method, which employs the ‘online’ detection of target nucleotide sequences while the amplification process is still in progress, requires expensive devices and consumables. In this study, we present a simple method that combines the simplicity of conventional PCR with new technical and methodical enhancements, resulting in a fast, specific and easy method for the molecular detection of C.burnetii. A collection of C.burnetii reference strains was tested with the modified conventional gel-based PCR approach applying a particluar PCR buffer (QIAGEN® Fast Cycling PCR kit) and using a closed ready-to-use gel-cassette-system (FlashGel®) for the visualization of specific PCR products. The modified conventional PCR method reached nearly the speed of the LightCycler® HybProbe real-time PCR assay (120 vs. 90min) and showed equal sensitivity and specificity. The general cost per PCR run was 25% less than that for the LightCycler method. These improvements make this method suitable for small laboratories with limited resources and for deployable PCR diagnostics in field laboratories.

  • Coxiella burnetii
  • PCR detection
  • real-time
  • improvement
  • deployable method

The diagnosis of Q fever, which is caused by the Gram-negative bacteria Coxiella burnetii, typically relies on the serological detection of specific antibodies. In recent years, PCR-based methods, which can detect different specific targets, have been introduced in diagnostic laboratories. In addition to use in veterinary medicine, where abortion-derived tissue or fluids, milk and faeces are routinely screened by PCR, this method has become widely used in clinical medicine as a supplement to serological techniques, especially for patients in the early stages of acute Q fever (Scola, 2002; Schneeberger et al., 2010).

In general, PCR requires specific instrumentation, and for the fastest and most reliable ‘real-time’ detection variant, expensive devices and consumables are needed. Therefore, application of PCR technology must consider economic aspects. Here we present a novel method that combines the simplicity of conventional PCR with new technical and methodical enhancements, resulting in the fast, specific and easy molecular detection of C. burnetii.

Ten C. burnetii reference strains (Nine Mile RSA 493, Namibia, Priscilla Q 177, F2, Scurry Q 217, Henzerling RSA 331, Herzberg, Balaceanu, RT 1140, Frankfurt) and 20 isolates from bacteria with similar clinical appearances were used (Pseudomonas aeruginosa, Citrobacter freundii, Acinetobacter baumanii, Enterobacter aerogenes, Escherichia coli, Legionella pneumophila, Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis, Burkholderia cepacia, Francisella tularensis holarctica, Yersinia pestis, Burkholderia mallei, Burkholderia pseudomallei, Brucella melitensis, Chlamydophila pneumoniae, Mycoplasma pneumoniae, Klebsiella pneumoniae, Mycobacterium tuberculosis, Listeria monocytogenes). The reference method was a LightCycler® HybProbe real-time PCR assay (Roche, Mannheim, Germany), which specifically detects the IS1111-repetitive elements of C. burnetii (Primers: CB_S4k: GAAACGGGTGTTGAATTGTTTG and CB_A2k: TCACATTGCCGCGTTTACT; probes: CB_LCR: LC Red640-TAATCACCAATCGCTTCGTCCCGGT and CB_Flu: GCCACCGCTTTTAATTCCTCCTC–FL; TIB MOLBIOL, Berlin, Germany). The detailed real-time PCR protocol has been described earlier (Stemmler & Meyer, 2002). For our new assay, we used these two primers (10 µM) in a standard, conventional PCR reaction containing PCR Master Mix (Invitrogen) with 1 U Taq polymerase, 2 mM MgCl2 and 0.2 µL dNTPs. After adding 2.5 µL of template DNA, the PCR was run on a Perkin Elmer 2400 GeneAmp PCR System. The program was 5 min at 95 °C, 45 cycles of 95 °C (30 s), 60 °C (1 min) and 72 °C (1 min), and a final elongation at 72 °C for 7 min. The amplicons were visualized in a 2% agarose gel run at 80 V for 40 min. To reduce the cycling time, the master mix from the QIAGEN® Fast Cycling PCR Kit (Hilden, Germany) was used with the same primer concentration (10 µmol). The protocol modifications were as follows: 35 vs. 45 cycles, cycles of 96 °C (5 s), 60 °C (5 s) and 68 °C (10 s), and a final elongation at 72 °C for 1 min. To accelerate the visualization with the gel electrophoresis method, a closed, ready-to-use gel-cassette-system (FlashGel®; Lonza, Cologne, Germany) was applied. One microlitre of amplicon was mixed with 4 µL of FlashGel loading dye, added to the 2.2% agarose gel-cassette and run at 275 V for 11 min.

The results of the three different protocols (LC-real-time PCR, conventional PCR and modified conventional PCR) are summarized in Table 1. All methods correctly identified all Coxiella strains and provided negative results with the specificity panel. In addition, similar sensitivities (down to 5.6 genome copies µL−1) were observed when using a 10-log dilution of the reference strain Nine Mile RSA 493. The improvement in the speed of the conventional PCR using standard reagents and a standard protocol when using the Qiagen Fast Cycling mix was impressive: the normal processing time was reduced from 3 h and 10 min to 1 h and 15 min. The visualization time with the gel-cassette-system was only 15 min vs. 1 h for the conventional method. Finally, the processing time for the entire PCR protocol with the combined enhancements in the master mix buffer and gel electrophoresis was 2 h. This elapsed time comes close to that for the LightCycler-real-time PCR protocol, which requires 1.5 h. Further advantages of the FlashGel cassette system are its ready-to-use nature, the lack of a need for any specialized infrastructure for storage and waste management, and the improvements in occupational safety and health. The economic comparison is also interesting. The costs for the instruments for conventional and FlashGel-PCR are significantly lower (between €2000 and €5000) than the cost for the real-time PCR platform (€15 000–40 000). The costs per PCR reaction are €0.68 (conventional), €1.75 (Qiagen + FlashGel) and €2.50 (LC-real-time).

View this table:

Processing times of the different PCR assays according to different performance parameter

Detection/PCR system
Performance parameterLightCycler®Conventional PCR-system (Invitrogen-Mix) + AgarosegelConventional PCR-system (Invitrogen-Mix) + Flashgel®Qiagen Fast Cycling + Flashgel®
Mastermix + template preparation30–35 min30–35 min30–35 min30–35 min
PCR55 min3 h 10 min3 h 10 min1 h 15 min
Agarose gel1 h
FlashGel®15 min15 min
Overall time1 h 30 min4 h 45 min4 h2 h
Run time (%)321008442

The modifications of the conventional gel-based PCR for the specific detection of C. burnetii presented in this study resulted in an impressive reduction in the processing and hands-on time without any loss in sensitivity or specificity. The modifications in the master-mix formulation of the commercial supplier were shown to enable a sufficient ratio of specific-to-nonspecific primer binding during the shortened annealing step of every PCR cycle. The buffer composition also seems to support the melting behaviour of DNA, allowing reduced denaturation and extension times. The other interesting assay improvement is the application of the closed gel-cassette-system from Lonza (FlashGel-System). The amplification products are separated extremely rapidly in precast, prestained agarose gels and buffer without the need for gel preparation, gel-staining or the addition of buffer. The combination electrophoresis and transilluminator unit (FlashGel Dock) provides both separation and detection in a notably fast and clean manner. Without the use of UV light, the built-in illumination could visualize the amplification products in 2–5 min under ambient light conditions without the need for additional eye protection.

Due to the ease of implementation, these improvements are especially suitable for small laboratories with limited resources or for deployable PCR diagnostics in field laboratories. This modified method may also represent an interesting model for the establishment of modern molecular techniques for clinical laboratory diagnosis in developing countries or regions with limited resources.


View Abstract