OUP user menu

Changing genotypes of cholera toxin (CT) of Vibrio cholerae O139 in Bangladesh and description of three new CT genotypes

Nurul A. Bhuiyan, Suraia Nusrin, Munirul Alam, Masatomo Morita, Haruo Watanabe, Thandavarayan Ramamurthy, Alejandro Cravioto, Gopinath Balakrish Nair
DOI: http://dx.doi.org/10.1111/j.1574-695X.2009.00590.x 136-141 First published online: 1 November 2009


We determined the genotype of cholera toxin by amplifying and sequencing the B-subunit in a sequential collection of 90 strains of Vibrio cholerae O139 isolated over the past 13 years since its first description in 1992. Representative strains isolated during 1993–1997 harboured ctxB of El Tor type (genotype 3). Twenty-six strains isolated during 1999, 2001, 2005 and three strains isolated in 1998, 2000 and 2002 were identified to belong to new ctxB genotypes 4 and 5, respectively. Genotype 5 was similar to genotype 1 except at position 28 (D→A). The genotype 6 was similar to genotype 4 except at position 34 (H→P). The implication of switch in terms of function of the toxin and its impact on human disease is unclear. How this change has influenced their prevalence relative to that of V. cholerae O1 in human infection is also not clear. The other common virulence gene clusters including the Vibrio pathogenicity island-1, Vibrio seventh pandemic island (VSP)-I and VSP-II of V. cholerae O139 did not show any remarkable difference from that of the O1 El Tor strains. Overall, the majority of the O139 strains tested in this study were similar to the El Tor strains but had altered ctxB genotype. This change and the impact that it causes to the epidemiology of cholera caused by O139 should be closely monitored.

  • Vibrio cholerae O139
  • cholera toxin
  • genotype


Vibrio cholerae O139 Bengal appeared in 1992 and was associated with large explosive outbreaks of cholera in India, Bangladesh and neighbouring countries (Albert et al., 1993a, b; Chongsa-nguan et al., 1993; Fisher-Hoch et al., 1993; Ramamurthy et al., 1993; Faruque et al., 1998). Imported cases of cholera due to V. cholerae O139 were also reported from the United States and Europe (Centers for Disease Control and Prevention, 1993; Cheasty et al., 1993). This new serogroup initially replaced the existing V. cholerae O1 serogroup, which gave the impression that V. cholerae O139 might become the new pandemic serogroup of cholera (Albert et al., 1993a; Chongsa-nguan et al., 1993; Fisher-Hoch et al., 1993; Iida et al., 1993; Rivas et al., 1993; Siddique et al., 1994). Extensive genetic studies showed that the O139 strain evolved from the seventh pandemic El Tor biotype by horizontal transfer of novel O antigen genes (Karaolis & Reeves, 1994). Studies carried out in two coastal areas on the epidemiology and ecology of V. cholerae O1 and O139 showed that cholera is endemic and seasonal in Bakerganj and Mathbaria, and the coastal ecosystem of the Bay of Bengal is concluded to be a significant reservoir for the epidemic serogroups of V. cholerae (Alam et al., 2006).

From 1994 to the middle of 1995, in most northern and central areas of Bangladesh, the O139 vibrios were replaced by a new clone of V. cholerae O1 of the El Tor biotype, whereas in the southern coastal regions, the O139 vibrios continued to prevail (Faruque et al., 1996, 1997, 1999). During late 1995 and 1996, cases of cholera caused by both V. cholerae O1 and O139 were again detected in various regions of Bangladesh. Since 1996, cholera in Bangladesh has been caused mostly by V. cholerae O1 of the El Tor biotype and only a few cases of O139 have been observed. We have previously reported different phenotypic and genetic changes in V. cholerae O139 in Bangladesh and the prevalence of different clones (Faruque et al., 1993, 1995; Albert et al., 1997). From early March to the end of April 2002, the epidemiology of cholera in Bangladesh changed again and a large outbreak of cholera caused predominantly by V. cholerae O139 occurred in the capital city Dhaka and adjoining areas (Faruque et al., 2003).

Cholera toxin (CT) is the principal toxin produced by V. cholerae O1 and O139 and is responsible for most of the manifestations of cholera. Three types of ctxB genes based on three nonrandom base changes resulting in a change in the deduced amino acid sequence have been described (Olsvik et al., 1993). Genotype 1 is found in strains of classical biotype worldwide and the US Gulf Coast, genotype 2 is found in El Tor biotype strains from Australia, and genotype 3 is found in El Tor biotype strains from the seventh pandemic and the Latin American epidemic (Olsvik et al., 1993). The genotype of the CT of the El Tor strains currently associated with cholera in Bangladesh and India has shifted from genotype 3 to genotype 1. Thus, in effect, the present El Tor biotype strains produce CT of the classical biotype (Nair et al., 2006; Raychoudhuri et al., 2009). The changes in the genotype of the CT of El Tor V. cholerae O1 was the impetus to determine the genotype of CT among a sequential set of clinical isolates of V. cholerae O139 in Bangladesh.

Materials and methods

Bacterial strains

Ninety strains of V. cholerae O139 isolated between 1993 and 2005 were included in this study. These strains were selected to represent different months within a year and from different years and were obtained from the International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B) culture collection. The number of strains selected in this study varied from 2 to 22 per year and is related to the proportion of V. cholerae O139 strains isolated from cholera patients each year. All strains were isolated from inpatients admitted with acute watery diarrhoea to the cholera hospital of ICDDR,B in Dhaka. The identities of the strains were reconfirmed by slide agglutination test using specific antiserum (Qadri et al., 2002) and were subcultured on gelatin agar plates and stored at −80 °C in Luria–Bertani (LB) broth containing 25% glycerol for further study.

Mismatch amplification mutation assay (MAMA)-PCR

Strains were subcultured on gelatin agar plate and a single colony was inoculated in 3 mL LB broth and incubated at 37 °C in a water bath shaker at 120 r.p.m. for 18 h. One millilitre of the culture was centrifuged and the pellet was resuspended in 1 mL reagent grade water and boiled for 10 min. The boiled cell suspension was centrifuged at 11600 g for 10 min at 4 °C and the ice-chilled supernatant was used as the template DNA. MAMA-PCR was used to determine whether the CT of the O139 strains belonged to genotype 1 (classical type of CT) or to genotype 3 (El Tor type of CT) (Morita et al., 2008). The primer sequences for the amplification of ctxB gene alleles are shown in Table 1. Vibrio cholerae O1 isolates (classical O395 and El Tor N16961) were used as standard reference strains.

View this table:
Table 1

Nucleotide sequence of primers used in this study

PrimersPrimer sequence (5′–3′)Amplicon size (bp)References
ctxB-FGGTTGCTTCTCATCATCGAACCAC460Siddique et al. (1994)
MAMA-F (conserved)ACTATCTTCAGCATATGCACATGG186Mitra et al. (2001)

Genomic DNA isolation

For extraction of genomic DNA, cells were harvested from 3 mL of overnight culture in LB broth (Miller). The harvested cells were subjected to alkaline lysis by 10% sodium dodecyl sulphate (SDS) in the presence of TE buffer (10 mM Tris-HCl; 1 mM EDTA, pH 8.0). The cells were then treated with freshly prepared Proteinase K (final concentration 100 µg mL−1 in 0.5% SDS) incubated at 37 °C for 1 h. After incubation, 1.0% CTAB/NaCl (cetyl trimethyl ammonium bromide in 0.7 M NaCl) was added followed by incubation for 10 min at 65 °C. RNA was removed by treating with RNAse (final concentration 100 µg mL−1) at 37 °C for 1 h. This was followed by phenol chloroform extraction and precipitation of the nucleic acid in the presence of isopropanol (Chowdhury et al., 2000). Excess salt was removed by 70% alcohol wash and the nucleic acid was air-dried, resuspended in sterile TE buffer. The purity of the DNA was assayed using a spectrophotometer (Gene Quant, UK) that self calculates the ratio of OD260 nm and OD280 nm, and the DNA was stored at −20 °C for subsequent PCR analysis.

Multilocus virulence gene profiling

We used a multilocus virulence gene profiling that scanned for nine virulence-associated genes and/or gene clusters in the genome of 13 representative V. cholerae O139 strains by year (1993–2005) and a reference strain each of the classical (O395) and El Tor (N16961) using 33 sets of PCR primers and conditions described previously (Keasler & Hall, 1993; Chow et al., 2001; Rivera et al., 2001; Nusrin et al., 2004; O'Shea et al., 2004). PCR was performed in a 20-µL reaction mixture as follows: an initial denaturation step at 96 °C for 1 min followed by 30 cycles of denaturation at 94 °C for 30 s, primer annealing at 45–58 °C for 30 s, 1–4 min of primer extension at 72 °C and 7 min of final extension at 72 °C for one cycle. Amplicons were separated by agarose gel electrophoresis (1%) in 0.5 × Tris-Borate-EDTA buffers. The PCR products were analysed by electrophoresis in 1% agarose gels, stained with ethidium bromide, visualized under UV light and recorded using a gel documentation system (Gel Doc™ 2000, BioRad, Hercules, CA). The PCR products were sized with standard molecular weight markers and documented.

Nucleotide sequence of ctxB subunit

We included 35 V. cholerae O139 strains representing the years 1993 to 2005 The strains isolated during 1993–1998, 2002 and 2005 were genetically homogeneous as detected by other molecular methods (data not shown). The reappeared strains during 1999–2001, and again in 2005, were genetically heterogeneous and hence we included as many as 26 strains for further characterization. To determine the nucleotide sequence of the ctxB subunit of CT, PCR amplification of ctxB genes of 35 strains (mentioned above) of V. cholerae O139 were performed in a 25-µL reaction mixture in an automated Peltier thermal cycler (PTC-200, M. J. Research). PCR primers and conditions were as described previously (Mitra et al., 2001). PCR products were purified with a Microcon centrifugal filter device (Millipore Corporation, Bedford, MA) and sequenced using an ABI PRISM BigDye Terminator Cycle Sequencing Reaction kit (Applied Biosystems, Foster City, CA) on an ABI PRISM 310 automated sequencer (Applied Biosystems). The nucleotide sequence data generated using different V. cholerae O139 were submitted to GenBank with accession numbers FJ821556FJ821590.

DNA and protein sequence analysis

The chromatogram sequencing files were inspected using chromas 2.23 (Technelysium). Nucleotide sequences of the test isolates were compared with the corresponding sequences of the N16961 El Tor reference strain (NC_002505), the 569B classical reference strain (U25679), retrieved from GenBank using basic local alignment search tool (Altschul et al., 1997). Multiple sequence alignments were developed using clustalx 1.81.13, and DNA sequences were translated using genedoc version 2.6.002 alignment editor.



The ctxB genes of a total of 90 strains of V. cholerae O139 isolated over a period of 13 years were examined using the CT primers specific for genotype 1 (classical type CT) and genotype 3 (El Tor type CT) (Morita et al., 2008). As shown in Table 2, the CT of all V. cholerae O139 strains isolated between 1993 and 1997 belonged to genotype 3. The CT of 17 strains of V. cholerae O139 isolated in the years 1998 and 1999 belonged to genotype 3, and three strains were positive for genotype 1. From 2000 to 2005, there was a complete replacement of genotype 3 by genotype 1 (Table 2).

View this table:
Table 2

Characteristics of CT-B subunit of Vibrio cholerae O139 strains isolated between 1993 and 2005

No. positive by MAMA-PCR
Year of isolationNo. of strainsPlace of isolationClassical CT (genotype 1)El Tor CT (genotype 3)

Multilocus virulence gene profiling

Of the 90 V. cholerae O139 strains, 13 were selected representing different years for the multilocus virulence gene profiling. For purposes of comparison, we also included a reference strain each of the classical (O395) and El Tor (N16961) biotypes. The presence or absence of the various genes was scored by PCR with specific primers using DNA extracted from cultured strains. The 13 strains showed the presence of all genes comprising Vibrio seventh pandemic island (VSP)-I, VSP-II, MSHA and RTX gene clusters (Table 3). The two individual loci, namely, hlyA and pilE, were also present in all the test strains as well as in the classical and El Tor reference strains. In the Vibrio pathogenicity island (VPI)-1 gene cluster, the major virulence-associated genes toxT, tcpA and acfB were present in all the 12 test strains and one strain AJ-937 was negative for the toxT gene but positive for tcpA and acfB genes. In this study, we tested for two genes of the RTX gene cluster, rtxC and rtxA; both were present in all the 12 strains, whereas one strain NHCM0273 was negative for rtxC but positive for rtxA. The CTX prophage genes such as rstA, orfU, zot and ctxAB were detected in all strains. The recognized allele, rstR2 of the repressor gene rstR, was present in the 11 test strains and the El Tor reference strain. In the remaining two strains, one (strain 7371) contained the alleles rstR2 and 3, and the other one (strain MP-1950) contained the alleles rstR1, 2 and 3 of the rstR gene. Apart from this, two other genes, tlc, which is present adjacent to the CTX prophage, and integron (intl4), were present in all the strains except strain MP-2021. The results of virulence gene profiling indicated that all the V. cholerae O139 strains isolated in Bangladesh between 1993 and 2005 were similar to the reference El Tor strain N16961 of the seventh pandemic.

View this table:
Table 3

Genotypes of Vibrio cholerae O139 strains based on the DNA sequence of the CT-B subunit genes

Nucleotide at positionAmino acid at position
Strain identificationNo. of strains831011151382032834394668ctxB genotype
Classical, 569B1AACTCDHHFT1
El Tor, Australia6AACGCDHHLT2
El Tor, N169611AATTTDHYFI3
V. cholerae O139 (1993–1997)5AATTTDHYFI3
V. cholerae O139 (1999–2001, 2005)26AATTCDHYFT4
V. cholerae O139 (1998, 2000, 2002)3CACTCAHHFT5
V. cholerae O139 (2005)1ACTTCDPYFT6
  • New CT genotype 4.

  • New CT genotype 5.

  • New CT genotype 6.

DNA and protein sequence analysis of ctxB

Nucleotide sequence analysis of the ctxB genes of 35 representative V. cholerae O139 strains isolated between 1993 and 2005 using specific primers (Mitra et al., 2001) showed that the five strains from 1993 to 1997 possessed amino acid sequences identical to the El Tor type of CT-B subunit, which was 100% identical to the amino acid sequence of El Tor reference strain N16961 of genotype 3 by having aspartate at position 28, tyrosine at position 39, phenylalanine at position 46 and isoleucine at position 68 (Table 3). In contrast, the amino acid sequence of the CT-B subunit of the 26 strains isolated from 1999 to 2001 and 2005 differed from the deduced amino acid sequence of El Tor reference strain N16961 only at position 68, where isoleucine was replaced by threonine. The amino acid sequence of the three strains isolated in 1998, 2000 and 2002 has alanine at position 28, in comparison with the El Tor and classical reference strains, which have aspartate at the same position, and has histidine, phenylalanine and threonine at positions 39, 46 and 68, respectively, the same as the classical reference strain 569B of genotype 1. The amino acid sequence of the remaining strain from 2005 was identical to the sequence of 26 strains mentioned above except at position 34, where proline was present instead of histidine. From our study, we found that the amino acid sequence of the CT-B subunit of V. cholerae O139 strains has shifted from the amino acid sequence of both the El Tor and classical reference strains of genotypes 3 and 1, and also from the Australian El Tor strains of genotype 2 (Olsvik et al., 1993). We designated these new genotypes as genotypes 4, 5 and 6 (Table 3) of the CT-B subunit of V. cholerae O139.


In this study, the O139 strains isolated during 1993–1997 had the ctxB gene similar to that of El Tor type (type 3). This is further direct evidence that the O139 strains evolved from the El Tor vibrios. The reemerged O139 strains during 1998–2005 had the new genotypes 4, 5 or 6. To our knowledge these three genotypes have not been reported among any of the CT-producing V. cholerae O1 and O139 strains. Emergence of O1 El Tor strains having classical ctxB (CT genotype 1) is a major concern in the Indian subcontinent and neighbouring countries because of the reported increase in severity of cholera attributed to this subtle change from El Tor to classical CT (Safa et al., 2008; World Health Organization, 2008; Raychoudhuri et al., 2009; Taneja et al., 2009). Interestingly, none of the O139 strains had the typical classical ctxB genotype. As the incidence of O139 serogroup has declined in recent years, the importance of this serogroup in the epidemiology of cholera is still unknown. The interplay of a variety of factors in the aquatic environment and genetic and phenotypic changes in V. cholerae, as well as immune status of the human host, may contribute to the existence and dominance of different clones of toxigenic V. cholerae. The factors that induce the change in the ctxB gene and its advantage for the pathogen should be studied in detail. The change in the ctxB sequences did not alter the phenotypic characteristics of O139 strains (data not shown). Unlike V. cholerae O1, the incidence of V. cholerae O139 serogroup in Bangladesh and in many cholera-endemic countries, is not stable over the years and hence it is difficult to draw any conclusions on the evolutionary significance of O139 strains having new CT genotypes. There are apparently no functional changes to the expressed CT, as the patients still presented with typical cholera symptoms.

We further checked different virulence-associated genes including the VPI-1 and the VSP-I and VSP-II. Similar to the El Tor biotype, all the O139 strains isolated in this study harboured VSP-I and VSP-II. As reported by previous investigators (O'Shea et al., 2004), only the classical strains did not harbour the 14 genes representing VSP-I and VSP-II. As the intact VPI-2 gene is present only in the El Tor biotype (Jermyn & Boyd, 2002), we did not test the O139 strains for this cluster of genes. Overall, the majority of the O139 strains tested in this study were similar to the El Tor strains but had an altered genotype of ctxB. This change should be closely monitored considering the rampant occurrence of El Tor biotype strains producing classical CT, mostly associated with several outbreaks (Kumar et al., 2009; Taneja et al., 2009).


he work was supported by Program of Founding Research Center for Emerging and Reemerging Infectious Diseases, Ministry of Education, Culture, Sports, Science and Technology of Japan and ICDDR,B. ICDDR,B acknowledges the following donors which provide unrestricted support to the Centre's research efforts: Australian Agency for International Development (AusAID), Government of the People's Republic of Bangladesh, Canadian International Development Agency (CIDA), Embassy of the Kingdom of the Netherlands (EKN), Swedish International Development Cooperation Agency (Sida), Swiss Agency for Development and Cooperation (SDC) and Department for International Development, UK (DFID).


  • Editor: Kai Man Kam


View Abstract