OUP user menu

Analysis of the role of pglI in pilin glycosylation of Neisseria meningitidis

Matthew J. Warren, Louise F. Roddam, Peter M. Power, Tamsin D. Terry, Michael P. Jennings
DOI: http://dx.doi.org/10.1016/j.femsim.2004.01.002 43-50 First published online: 1 May 2004

Abstract

Pilin is the major subunit of the essential virulence factor pili and is glycosylated at Ser63. In this study we investigated the gene pglI to determine whether it is involved in the biosynthesis of the pilin-linked glycan of Neisseria meningitidis strain C311#3. A N. meningitidis C311#3pglI mutant resulted in a change of apparent molecular weight in SDS–PAGE and altered binding of antisera, consistent with a role in the biosynthesis of the pilin-linked glycan. These data, in conjunction with homology with well-characterised acyltransferases suggests a specific role for pglI in the biosynthesis of the basal 2,4-diacetamido-2,4,6-trideoxyhexose residue of the pilin-linked glycan.

1 Introduction

Pili of pathogenic Neisseria are type IV fimbriae, a class of adhesins that are major virulence factors expressed by many Gram-negative pathogens including Pseudomonas aeruginosa[1]. Pili are assembled from thousands of the repeating subunits called pilin, the product of the pilE gene in Neisseria gonorrhoeae and N. meningitidis[2]. A key feature of this protein is the rapid alteration in its physical properties via antigenic and phase-variation. Antigenic variation of pilin occurs by changes in pilin sequence due to recombination between the expression locus pilE and multiple, silent genes pilS (reviewed by [3]). Pilin is post-translationally modified by addition of a covalently-linked glycan structure. N. meningitidis strain C311#3 is glycosylated by a trisaccharide, Gal(β1–4)Gal(α1–3)[2,4-diacetamido-2,4,6-trideoxyhexose] (DATDH), which is O-linked to Ser63 [4] (see Fig. 1). In N. gonorrhoeae strain MS11 there is an O-linked disaccharide, Gal(α 1–3)GlcNAc, also covalently linked to Ser63 [2]. The same disaccharide is also O-linked at Ser63 in N. meningitidis strain 8013SB [5]. Glycosyltransferases involved in the biosynthesis of these structures have been identified [69]. The genes encoding these glycosyltransferases are subject to phase-variation resulting in variation of the glycan structure. Phase-variation is the high frequency switching on and off of expression and is often due to the presence of simple repeats [10]. A series of pilin-glycosylation genes has been described, however the process of pilin-glycosylation is not completely elucidated [69]. Defining the precise role of pilin-glycosylation in host interactions awaits the complete elucidation of the genes involved in its biosynthesis.

Figure 1

Trisaccharide structure attached to Ser63 pilin of N. meningitidis C311#3 [7,28].

2 Materials and methods

2.1 Bacterial strains and media

Meningococcal strains used in this study were N. meningitidis C311#3 [11] and its previously analysed pilin glycosylation mutants [68], and a collection of clinical isolates [12]. Meningococcal strains were grown on Brain Heart Infusion agar (BHI; Oxoid) at 37 °C with 5% CO2 for 16–18 h. BHI plates were made with 1% agar and supplemented with 10% Levinthals Base [13]. All recombinant plasmids were replicated in E. coli DH5α and grown on Luria–Bertani (LB) media [14]. LB agar plates were supplemented with 1.5% agar (Difco). Ampicillin (amp) and kanamycin (kan) were used in media at a final concentration of 100 µg/ml, Tetracyclin (tet) was used at a final concentration of 5 µg/ml.

2.2 DNA manipulation and analysis

Routine DNA manipulations were carried out essentially as described in Sambrook et al. [14]. Nucleotide sequencing was carried out using the Big Dye Terminator kit [14]. The homopolymeric tract of pglI was sequenced using the primers MWK1 and MWK3 (see Table 1 for primer sequence). PCR was essentially done as previously described [15]. Nucleotide analysis was performed using the MacVector program (Accelrys Inc.).

View this table:
Table 1

List of PCR primers used

NameSequencePositionReference sequence
MWK1AACATTATGAGCCAAGCCTTACCC8260–8283AE002533
MWK3GTATCGGCGGCGCAGCAGGGGCTTTTCTTCCTGC7865–7885 rcAE002533
MWK8TGCAAACCGCCGATTGTAAC6373–6392 rcAE002533
HP14TTGAAGTCGACGGGAGTAATTGGAAG13061–13077U49939
HP15TAAAAGTCGACATACATAACGGAAAGAG15702–15719 rcU49939
HP16CCTTTGTCCACGCTTCCT13564–13581 rcU49939
KanUp OutTCCCGTTGAATATGGCTCA1516–1534 rcX06404
PglE1FAAGTAATGAAAATGTCGAACTTA1519–1541AE002418
PglE3RCGGAAATTTTCTAAATCGGCA2418–2168 rcAE002418
PilE-HisBTCACCCAAGCTTTTAGCTATCACTTGCGT5003–5027AE002360
PilE-HisCGGATCCATGAACACCCTTCAAAAAGG3983–4002AE002360
RfpB 14TTCGGAAACATTGTTCACAA7666–7647 rcAE002379
RfpB 9TTTTCGGCACTTTTGCCGCA8173–8154AE002379
  • rc – reverse compliment.

  • Nuceotide position with reference to GenBank accession number.

  • This primer includes a Eag I restriction enzyme site which is underlined.

  • This primer includes a Sal I restriction enzyme site which is underlined.

2.3 Southern blotting and hybridisation

Restriction endonuclease (BssH II) digested DNA was separated on a 1% agarose gel and blotted onto GeneScreen PVDF membrane (Perkin–Elmer) as described previously [14]. The primers MWK1 and MWK8 were used to amplify the region of pglI (see Fig. 2) that was purified using the QIAquick gel extraction kit (Qiagen). This product was labelled using the DIG-High prime DNA labelling kit (Roche) and hybridisation was performed as per the manufacturer's instructions.

Figure 2

Restriction, plasmid and ORF map of the pglI region. The thick black line represents the N. meningitidis C311#3 chromosome. Thick filled arrows represent the size and orientation of the ORFs. Thin arrow lines represent the oligonucleotide primers (see also Table 1). The line with boxes at the end represents the cloned fragment. The open boxes represents the cloning vector pGEM-T-easy (Promega®).

2.4 Formation of the tetracycline resistance cassette for the study of pathogenic Neisseria

The tetM gene from pAM120 (GenBank accession number U49939; [16]) was amplified by PCR using primers HP14 and HP15 containing Sal I restriction sites (see Table 1 for primer sequence). The PCR product was cloned in both orientations into pGEM-T easy® (Promega) to create pGEM-TetMA and pGEM-TetMB.

2.5 Formation of knockout constructs of pglI

The pglI construct to be used for the insertional inactivation of the pglI gene was made by cloning the PCR product of the primers MWK1 and MWK8 into the cloning vector pGEM-T easy® (Promega) resulting in the plasmid pPglIC4 (see Table 1 for primer sequences; Fig. 2 for primer binding sites). A kanamycin resistance cassette was excised from pUK4kan (Amersham Biosciences) by digestion with Hin cII and ligated into the unique Sma I site in the pglI coding sequence in the same orientation as the ORF resulting in the plasmid pPglI4Kan. The tetracycline resistance cassette was excised from pGEM-TetMA by digestion with Sal I and ligated into the unique Ava I site of pPglIC4 to create the plasmid pPglIC4TetM.

2.6 Insertional inactivation of pglI in N. meningitidis

The pPglI4Kan construct was linearised using the restriction enzyme Not I and transformed into N. meningitidis C311#3 as previously described [7]. Kanamycin resistant colonies were screened for the correct insertion of the kanamycin resistance cassette by PCR using the primers MWK1 and KanUpOut (see Table 1 for primer sequence) and Southern hybridisation (using the DIG labelled PCR product of the primers MWK1 and MWK8; see Table 1 for primer sequence) essentially as described in previous studies [7], resulting in the N. meningitidis strain C311#3 pglI.

The pPglI4Tet construct was linearised using the restriction enzyme Not I and N. meningitidis C311#3 pglA was transformed as previously described [7]. Tetracycline resistant colonies were screened for the insertion of the tetracycline resistance cassette by PCR using the primers MWK1 and HP16 (see Table 1 for primer sequence).

2.7 Sequencing of variable pilin associated loci

To ensure any migration differences in SDS–PAGE were not due to changes of variable pilin-associated loci these were sequenced. The highly variable pilE gene was sequenced using the primers PilE-HisB and PilE-HisC (see Table 1 for primer sequence) and compared to the parent C311#3 pilE locus (GenBank accession number X07731). The repeats of the phase-variable pilin-glycosyltransferase genes pglA and pglE were sequenced using the primers RfpB9 and RfpB14; and PglE1F and PglE3R respectively and compared to the parent strain sequence (GenBank accession numbers U73942 and AY028717, respectively).

2.8 SDS–PAGE and western immunoblotting

Pilin from the parent strain C311#3 and the various C311#3 mutants was isolated and electrotransfer of samples separated on 12% SDS–PAGE was performed as previously described [7]. These samples were analysed by western blotting using the monoclonal antibody (mAb) SM1 (specific for pilin; [17]) and the previously described polyclonal anti-C311 and anti-pglA antisera (specific for the trisaccharide and the pilin-linked glycan of the pglA mutant, respectively [7]).

2.9 ELISA analysis of anti-serum binding efficiencies

Semi-pure pilin was obtained via electroelution for N. meningitidis C311#3 and its pglA and pglI mutants. The ELISA was performed as previously described [18] using the mAb SM1 (specific for pilin; [17]) and the previously described polyclonal anti-C311 antisera [7].

3 Results

3.1 Identification of pglI and its possible role in biosynthesis of pilin-linked glycans

There are two acetamido groups on the basal sugar of the N. meningitis C311#3 pilin-linked glycan (see Fig. 1). A search of the N. meningitidis genome for acetyltransferase homologues identified an open reading frame (ORF), designated pglI, similar to the acetyltransferase wbpC of P. aeruginosa, which is involved in O-antigen synthesis (amino acid identity/similarity 31/43(%)) [19,20].

pglI, annotated as NMB1836 of the N. meningitidis MC58 genome is located between the upstream hypothetical ORF (NMB1837) and the downstream proposed tyrosyl-tRNA synthetase (NMB1835). The pglI ORF is 1872 nucleotides (nt) in length, contains a poly-guanosine repeat sequence 177 nt downstream of the start codon and has been noted as a potentially phase-variable gene of unknown function [10,21]. Homopolymeric nucleotide tracts mediate phase-variation of expression (high frequency, reversible on/off switching) by generating frame-shift mutations via the loss or addition of repeat units, and are found in a number of genes encoding glycosyltransferases in pathogenic Neisseria (homopolymeric guanosine or cytosine tracts) [2224]. The pglI gene of N. meningitidis strain C311#3 was sequenced in full and submitted to GenBank (GenBank accession number AF517645). PglI is predicted to contain up to 10 transmembrane regions (HMMTOP; [25]), has a predicted molecular mass of 70.4 kDa and a pI of 9.47 (MacVector, Oxford Molecular).

3.2 Insertional inactivation of pglI

To analyse the effect of pglI on pilin glycosylation it was inactivated by the insertion of kanamycin resistance cassette into the coding region. This construct was used to transform the well-characterised pilin glycosylation strain N. meningitidis C311#3 and the presence of the inactivated allele was confirmed by both PCR and Southern hybridisation (data not shown).

3.3 pglI is not involved in gross changes to LPS biosynthesis

The highest similarity to pglI was wbpC and oafA which are involved in O-antigen synthesis [19,20]. To determine whether pglI had a role in the biosynthesis of LPS, the LPS phenotype was examined by SDS–PAGE as previously described [26]. The migration of LPS from the C311#3pglI mutant was compared to the parent strain and the previously described C311#3galE mutant [4]. The galE mutant is unable to synthesise UDP-galactose, resulting in a truncation of the LPS to the terminal galactose moieties and was therefore used as a standard for LPS migration differences [27]. The silver-stained gel showed there was no difference in the migration of pglI LPS compared to the parent strain indicating there was no gross change in LPS (see Fig. 3(a)).

Figure 3

Analysis of pilin and LPS from N. meningitidis C311#3 and its mutants pglA, pglI and galE. (a) Silver-stained LPS gel. (Arrow head represents the 14.9 kDa prestained molecular mass marker (BenchMark, Gibco BRL)). Western blot of pilin isolated from C311#3pglI, C311#3 and C311#3pglA detected by (b) the mAb SM1 (specific for class I pili of Neisseria). (c) The anti-C311 antiserum (trisaccharide specific). (d) The anti-pglA antiserum (monosaccharide specific) (Arrow heads represents the 19.6 kDa prestained molecular mass marker (BenchMark, Gibco BRL)). (e) ELISA with anti-C311 antiserum. C311#3pglI grey column, C311#3 black column, C311#3pglA white column. (f) Western blot of pilin isolated from C311#3, C311#3pglI, C311#3pglA and C311#3pglIpglA detected by the mAb SM1 (Arrow head represents the 19.6 kDa prestained molecular mass marker (BenchMark, Gibco BRL)).

3.4 Inactivation of pglI results in changes to apparent molecular weight of pilin

Pilin from the parent strain N. meningitidis C311#3, the C311#3pglI mutant and other mutants was isolated as previously described [7] and analysed by western immunoblots using antibodies specific for pilin and pilin-linked glycan. The monoclonal antibody (mAb) SM1 [17] was used to determine the presence of pilin and visualise relative molecular weight changes. The previously described C311#3pglA mutant was used as a standard as it lacks the terminal digalactose moiety and therefore has an increased migration compared to that of the parent strain (see Fig. 1) [7,28]. SDS–PAGE analysis showed there was a decrease in the apparent molecular weight of the pilin isolated from the pglI mutant, although the change in migration was not as large as that of the C311#3pglA mutant (missing the terminal digalactose moiety [8]; see Fig. 3(b)).

3.5 The increase in migration is not due to variation of pilin amino acid sequence, glycosylation phase-variation or loss of pilin-associated phosphorylcholine

It was important to establish whether the observed molecular weight change was due to changes of variable pilin-associated structures, which include the expressed pilin locus (pilE) sequence, presence of the phase-variable phosphorylcholine epitope and phase-variation of pilin glycosylation genes pglA[8] and pglE[6].

Pilin has a high degree of variation especially toward the C-terminus due to changes in the gene pilE. This variation in the gene results in migration shifts on SDS-PAGE [3]. Therefore the pilE gene was amplified by PCR, sequenced and compared to the parent C311#3 pilE gene to ensure that the pilin of the C311#3pglI mutant was the same as the parent strain as previously described [6]. The pilE sequence of strain C311#3pglI was unchanged.

Another source of potential variations in apparent molecular weight changes is the result of phase-variation of the glycosyltransferases pglA and pglE. Sequencing of the polymeric tracts of the pglA and pglE genes, as previously described [6,8], confirmed that both genes were in-frame in the C311#3pglI mutant as is seen in the parent strain. Phosphorylcholine is a phase-variable epitope attached to the pilin of pathogenic Neisseria[29]. The presence of phosphorylcholine on pilin from the C311#3pglI mutant was confirmed using the mAb TEPC-15 on western immunoblots [29] (data not shown). As the change to pilin migration of the C311#3pglI mutant was not due to changes in either the pilE sequence or other characterised modifications, we conclude that the alteration in pilin migration is due to inactivation of the pglI gene.

3.6 Inactivation of pglI results in changes to trisaccharide specific antiserum binding to pilin

Antiserum specific for the pilin-linked trisaccharide of C311#3, “anti-C311 sera” (described previously [7]), was used in a western immunoblot against semi-purified pilin from wild type and both the C311#3pglI and C311#3pglA mutants. The anti-C311 sera showed reduced binding to C311#3pglI pilin compared to wild type (see Fig. 3(c)). ELISA analysis showed that although the SM1 binding was approximately equivalent for all samples there was a 2.5 fold reduction in binding by the anti-C311 antisera to the pilin from the C311#3pglI mutant compared to the parent strain, while there was minimal amounts of binding to the pilin from the C311#3pglA mutant (see Fig. 3(e)). This indicates that the pglI mutation resulted in a change to the epitopes present in the trisaccharide structure, confirming that pglI has a role in pilin-linked glycan biosynthesis.

3.7 Inactivation of pglI in the pglA mutant results in a further change to the apparent molecular weight of the pilin

To determine whether the terminal digalactose moiety was still present in the C311#3pglI pilin-linked glycan, the pglI gene was inactivated in the previously described C311#3pglA mutant (lacks the terminal digalactose; [8]) to create the C311#3pglIpglA mutant. N. meningitidis C311#3pglA was transformed with pPglIC4TetM and tetracycline resistant colonies were isolated, and the presence of the inactivated allele was confirmed by PCR (data not shown).

The pilin from the C311#3pglIpglA mutant was compared to that of C311#3 and the C311#3pglI and C311#3pglA mutants by western immunoblot with the mAb SM1. The change in migration of the pilin from the C311#3pglIpglA double mutant compared to the C311#3 parent strain was greater than that of the C311#3pglI mutant alone (see Fig. 3(f)). The pilE gene was sequenced to confirm that the change in apparent molecular weight was not due to changes in this highly variable gene. This indicates that the terminal digalacotose moiety is present on pilin of the C311#3pglI mutant.

3.8 Phase-variation of pglI

Phase-variable of expression of surface structures is a common feature of host adapted pathogenic bacteria [3032]. The poly-guanosine tract from pglI was sequenced from a variety of pathogenic Neisseria strains including patient isolates to help determine whether pglI was able to switch expression. This data showed that the pglI gene was present in all strains analysed (including all 6 patient isolates) and the number of guanosine residues is variable (between 6 and 15 residues). The variation of the repeat length results in ORFs that are both in and out of frame (see Fig. 4). There were noticeable differences between the pglI repeat tracts of N. meningitidis and N. gonorrhoeae. In N. gonorrhoeae all of the analysed strains had 6 repeats. Therefore the pglI gene is probably fixed in-frame, as repeats of less than 6 base-pairs are not considered to be phase-variable [33]. However, in N. meningitidis there is variation in the number of repeats (ranging from 10 to 15 guanosine's). This indicates that pglI is capable of phase-variation in N. meningitidis.

Figure 4

Sequencing of the poly G tract from various pathogenic Neisseria strains. Ng-N. gonorrhoeae, Nm-N. meningitidis. MPJ laboratory strains are patient isolates (see [12] for details). Separate cultures were obtained from various body compartments for each patient. A: Blood/CSF/Throat cultures. B: Throat. C: Buccal Cavity/Throat. D: Blood/CSF. E: Blood. The polymeric repeat was the same for each patient within each compartment.

4 Discussion

4.1 What is the function of PglI in C311#3 trisaccharide biosynthesis?

WbpC of P. aeruginosa is a member of the inner-membrane transacylase family, which have multiple membrane spaning regions and are involved in the acylation of carbohydrates [34]. Members of this family include OafA Salmonella typhimurium and PglI of N. meningitidis. In S. typhimurium OafA acetylates the O-antigen at the C2 position of abequose (3,6-dideoxy-galactose) and its inactivation results in intact LPS with the C2 acetyl group missing from abequose [19]. This loss of acetylation leads to a drastic change to the immunopresentation of the LPS structure causing a change in the binding of monoclonal antibodies and polyclonal antisera to the LPS [19,35].

Inactivation of the PglI homologue, OafA, in S. typhimurium results in the loss of only the acetyl group of an abequose residue and the LPS is otherwise unchanged [34]. This change results in modification of “the immunopresentation of this LPS”[34]. PglI is homologous to acetylases and the only acetyl groups in the C311#3 trisaccharide structure are present on the on the basal DATDH (see Fig. 1). The function of the PglI homologues (OafA and WbpC) and our experimental data presented above suggest that the pilin of the C311#3pglI mutant is glycosylated with a trisaccharide that consists of the terminal digalactose moiety linked to an altered O-linked basal sugar. This alteration would require the substrate specificity of PglI to be relaxed or to have specificity for a part of the basal sugar that is not affected by the PglI modification. Previous work has shown that PglA is able to catalyse the addition of the galactose via a α1–3 linkage to both the DATDH of N. meningitidis C311#3 and also to the GlcNAc of N. meningitidis 8013SB and N. gonorrhoeae MS11 demonstrating that PglA has some flexibility in its substrate specificity [9,36].

The presence of a homopolymeric tract has been confirmed in many studies as a marker for phase-variable expression in pathogenic Neisseria [22,23,26,3739], and is used to identify phase-variable genes in genomic analysis [10]. In addition to the presence of a large homopolymeric tract, pglI also displays variations in the number of repeats between strains, with the ORF both in and out of frame. These data strongly suggests that pglI is capable of phase-variation.

5 Conclusion

The pglI gene in N. meningitidis C311#3 is involved in pilin glycosylation and has no drastic effect on LPS biosynthesis. Analysis of the C311#3pglI mutant suggests that PglI is involved in the biosynthesis of the DATDH sugar of the C311#3 pilin-linked glycan. Sequencing of the pglI homopolymeric tract has shown that it is capable of phase-variation, which could be advantageous due to immunogenic or functional pressures within the host. These results, in conjunction with the homology, suggest that pglI is a phase-variable gene involved in pilin glycosylation.

Acknowledgements

The authors would like to thank D.B. Clewell for the supply of the pAM120 plasmid used in this study to make the pGEM-TetMA and pGEM-TetMB constructs. This work was supported by NHMRC Project grant 210310 to MPJ. MJW is supported by a University of Queensland Mid-Year Scholarship.

References

  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
  18. [18].
  19. [19].
  20. [20].
  21. [21].
  22. [22].
  23. [23].
  24. [24].
  25. [25].
  26. [26].
  27. [27].
  28. [28].
  29. [29].
  30. [30].
  31. [31].
  32. [32].
  33. [33].
  34. [34].
  35. [35].
  36. [36].
  37. [37].
  38. [38].
  39. [39].
View Abstract